Wordpress - anuacharya.wordpress.com - Janampatri to Genomepatri - Anu Acharya
General Information:
Latest News:
One bottling plant and the future of manufacturing in Myanmar 20 Jun 2013 | 05:36 am
One bottling plant and the future of manufacturing in Myanmar Visiting a bottling plant in Myanmar last week, the impression I got was certainly not of a country that got its freedom from military rul...
Ab DNA karaega shaadi- Genomepatri discovered on totaltv…. totalfun 23 May 2013 | 04:39 pm
Coverage in the Mumbai Mirror 23 May 2013 | 04:05 pm
Coverage in the Mumbai Mirror Genomepatri covered in the Mumbai mirror
Coverage in the Mumbai Mirror 23 May 2013 | 04:04 pm
Coverage in the Mumbai Mirror Genomepatri covered in the Mumbai mirror
Reality is what we take to be true 2 Apr 2013 | 01:44 pm
April 2nd 2013 The Master wasn’t teaching, But the student was learning, I was the observer I am told, My confusion increased multifold. There were patterns of organic energy, Of quantum theory, parti...
Now a Genomepatra to foretell your health 31 Mar 2013 | 07:48 am
Now a Genomepatra to foretell your health For the first time in India, find out from your saliva, what your genes can tell you about your future health. Aptly named Genomepatri, this test allows indiv...
Spit to keep fit with futuristic kit 30 Mar 2013 | 09:23 pm
Spit to keep fit with futuristic kit Subhasini Chandran runs 10 km regularly, and though she’s nearly 40, friends tell her she looks much younger. But when the Chennai-based writer heard that a simple...
Genomepatri(TM) is thy name 30 Jan 2013 | 01:03 pm
A little bit of saliva is all we need, To know the risk that we carry in our genes, of predisposition to a disease, or drug response if you please, your traits aren’t easy to hide, Within ...
Snippet SNPit Song – So Long 2012 … 24 Dec 2012 | 09:21 pm
- anu acharya ACTACTCATCATCACGACGACGCAGCAGCGCGATGCTGCGCTCGTCGTCGTCGTGGTCGTCGTCG Past, Present and looking at the future, Prediction is a sport serving as a society’s suture, Mayans, Incans, Romans, Gr...
Amorphous Alleles? 19 Nov 2012 | 03:58 pm
-Anu Acharya , 19th November 2012 ****************** There was once a gene, With oh! so many alleles If you looked at one, You hoped to run, Unlike the other one, Who seemed to have fun? ** It was jus...